Jing Yi, Department of Transfusion Medicine, Xijing Hospital, the Fourth Military Medical University, 127 Changle West Road, Xi'an, Shaanxi 710032, China. E-mail: yeluo@fmmu.edu.cn
Wen Yin, Department of Transfusion Medicine, Xijing Hospital, the Fourth Military Medical University, 127 Changle West Road, Xi'an, Shaanxi 710032, China. E-mail: yinwen@fmmu.edu.cn
Beyond their seminal role in hemostasis and thrombosis, platelets (PLTs) are now acknowledged as having multiple roles in the host's defense against infection. PLTs are proven to exert antimicrobial functions in vitro, ex vivo, and in vivo. However, different species of bacteria interact with PLTs differentially. Data concerning the interaction between PLTs and Staphylococcus epidermidis (S. epidermidis), the major prevalent species of nosocomial pathogens, and their related mechanisms are limited. In this study, the direct effects of PLTs on the metabolism and proliferation of S. epidermidis were evaluated. The PLTs from peripheral blood were purified and washed. The PLTs were found to significantly inhibit the proliferation of S. epidermidis when they were cocultured in vitro. Moreover, qRT-PCR showed that the expression of G6PD of the bacteria, a key enzyme in the pentose phosphate pathway, had been down-regulated signally. When the products (GDL, IMP) of the phosphate pentose pathway (PPP) were added to the culture, the antibacterial effect of PLTs was alleviated. This study suggests that PLTs can directly inhibit the proliferation of S. epidermidis and regulate their glucose metabolism, which may play an important role in their direct antimicrobial functions.
Staphylococcus epidermidis (S. epidermidis), the most ubiquitous commensal of skin and mucosa, has emerged over recent decades as the most prevalent species of nosocomial pathogens[1–3]. It is currently the major cause of catheter-related bloodstream infection, early-onset neonatal sepsis, and transfusion-transmitted bacterial infection, and is also a frequent cause of biomedical device-related infections such as prosthetic joint infection and prosthetic valve endocarditis[1, 4–7]. Furthermore, its high rate of resis-tance to antibiotics, for example, methicillin-resistant S. epidermidis, makes the situation worse[7–12]. Thus, new agents or strategies are needed for the control of S. epidermidis infections.
Platelets are small, anucleated, spherical cells produced from megakaryocytes which are widely known to have prominent functions in hemostasis and thrombosis[9]. The most well-known role of blood platelets is the maintenance of vascular integrity, which prevents spontaneous hemorrhage and primary hemostasis[13]. Since the late sixties, platelet concentrates have been transfused to patients with severe thrombocytopenia, platelet injuries, function defects, or those undergoing surgery, to prevent the risk of bleeding or to treat actual hemorrhage[14–15]. Platelets also possess the archetypal structures and functions of host-defense cells[16–17]. They express a variety of receptors (CC, chemokine receptor, CXC, chemokine receptor, GPIIb–IIIa, GPIba, FccRIIa, complement receptor, and TLRs), which enable them to exert direct antibacterial defense or exert indirect antibacterial defense by enhancing antibacterial innate immune, coordinating adaptive immunity[18–19], and soluble molecules (PMPs and kinocidins)[20–24]. Meanwhile, the clinical impact of platelet biology is burgeoning. It is known that quantitative or qualitative deficiencies in platelets can increase the risk of infection[25–26]. Clinical studies have demonstrated an inverse correlation between platelet number and adverse outcomes in septic syndrome[27–28].
Platelet kinocidins are already used as templates for novel anti-infective agents[29]. Furthermore, platelet rich plasma (PRP) has been demonstrated to reduce the growth rate of S. epidermidis, and the antibacterial activity of PRP strongly correlates with the concentration of platelets[30]. On the other hand, S. epidermidis is the most frequent aerobic pathogen isolated from contaminated platelet concentrates, which offer an accidental niche for the colonization of S. epidermidis by forming biofilms and thus avoiding clearance by immune factors[31]. However, the exact interaction between platelets and S. epidermidis and the mechanism are far from understood. An improved understanding of the unique roles of platelets and their interaction with S. epidermidis may result in innovative anti-infective agents or strategies.
In the present study, by using purified platelets from human peripheral blood, their direct effects on S. epidermidisin vitro were examined. The ultrastructure of S. epidermidis treated with platelets was observed with transmission electron microscopy. Further, the factors which influence the growth of S. epidermidis were analyzed by quantitative RT-PCR. To the best of our knowledge, this study represents the first exploration of the direct effects of platelets on S. epidermidis. Our findings provide new insights into the mechanisms of how platelets interact with S. epidermidis and may be beneficial to control S. epidermidis infections in the future.
MATERIALS AND METHODS
Preparation of purified human platelets
Purified human platelets were prepared as previously reported[32]. Briefly, human apheresis PLTs were centrifuged (750×g, 15 minutes) and washed with CGS solution (0.12 M sodium chloride, 0.0129 M citrate sodium, 0.03 M D-glucose, pH 6.5) 2 times. Then PLTs were resuspended in BHI medium to an ultimate concentration of 400×109/L. Meanwhile, plasma was collected and centrifuged (1000×g) for 10 minutes to remove cells.
To confirm the purity of washed PLTs, 1×106 washed PLTs were co-incubated with conjugated Abs against CD41 (HIP8, BioLegend, San Diego, CA, USA), CD19 (HIB19, BioLegend), and CD14 (MSE2, BioLegend) at room temperature. Samples were then analyzed by FACS Calibur (BD Biosciences, San Jose, CA, USA).
The optimal culture concentration of platelets and S. epidermidis were determined by serial dilution. The study was approved by the Xijing Hospital Ethics Committee and all volunteers for platelet donation provided written informed consent.
Bacterium culture and count
A single colony of S. epidermidis (American Type Culture Collection, Manassas, VA, USA) was inoculated to the Brain Heart Infusion Broth (BHI) medium (Qingdao hopebio Technology, China) and cultured for 24 hours at 37 ℃. Then 5 microliters of the bacterial solution were removed and transferred to another 10 mL BHI culture medium and incubated for 8 hours to the exponential growth phase. Bacterial concentration was determined using a spectrophoto-meter at 600 nm (UV-2550; Shimadzu, Kyoto, Japan).
For the study of platelets' anti-S. epidermidis effects, S. epidermidis (1×105 colony-forming units (CFU)/mL) were incubated in the presence or absence of purified platelets (400×109/mL) for 10 hours in BHI medium. The S. epidermidis culture was serially diluted and counted, and 100 μL diluted solution was plated on LB plates every 2 hours post co-culture for bacterium counting.
Determination of the proliferation rate of S. epidermidis
Using a Carboxyfluorescein Succinimidyl Ester (CFSE) Kit (Nanjing KeyGen Biotech, Nanjing, China), the proliferation of S. epidermidis was monitored. After lysozyme treatment for 30 minutes and washing with PBS buffer and centrifugation at 1200×g for 5 minutes, S. epidermidis was counted and stained with CFSE according to the manufacturer's instructions. Then, 1×105 CFU/mL of stained S. epidermidis was incubated with platelets or plasma. After co-culture for 10 hours, S. epidermidis was filtered through a 70-µm nylon cell strainer and analyzed via flow cytometry (BD Biosciences, San Jose, CA, USA).
Ultrastructure observation
S. epidermidis samples were fixed with 2.5% glutaraldehyde at 4 ℃ for at least 4 hours for slicing. Sections were then analyzed via transmission electron microscopy (JEM-1230, Jeol Ltd. Tokyo, Japan). Digital images were obtained by a CCD camera (Olympus N300M, Tokyo, Japan).
Glycometabolism analysis
To analyze the glycometabolism of S. epidermidis, we detected the expression level of the G6PD gene, which encodes a key enzyme for the pentose phosphate pathway (PPP). The quantitative RT-PCR. primers used were as follows: forward primer, ATCCAAGTTACATCTTCTGA; backward primer, ACTAATAGGTGCTTCCATAG.
Two downstream molecules of G6PD, GDL (5 mM, Xinhong Pharmacy, China) and IMP (2.4 mg/mL, Xinhong Pharmacy, China), were added into the S. epidermidis and platelet co-culture system. Ten hours later, the culture medium was serially diluted and 100 μL dilution was plated on LB agar plates. After overnight culture at 37 ℃, the CFUs were counted.
Statistical analysis
For statistical analysis, the software Graphpad prism 5 (GraphPad Software, La Jolla, CA, USA) was used. The Student's t-test was used for comparing the means of each group. Results are expressed as mean ± SD. Statistical significance was assumed at P<0.05.
RESULTS
Platelets directly inhibited the growth of S. epidermidis in vitro
As shown in Fig. 1A, the turbidity of S. epidermidis co-culture medium treated with platelets was lower than that of S. epidermidis cultured alone or with plasma 10 hours later. This indicates that platelets and plasma both have direct antibacterial effects, with platelets having a stronger antibacterial effect. Subsequently, the growth curves of S. epidermidis were generated, incubated alone and co-cultured with platelets or plasma. Platelets showed a delayed but longer-lasting antibacterial effect on S. epidermidis than plasma (Fig. 1B–C). The anti-S. epidermidis effect of platelets began 6 hours after co-culture and lasted more than 20 hours, while that of plasma began 4 hours after co-culture and dropped 10 hours later. These results suggest that platelets have their own antimicrobial ability, which differs from that of plasma.
Figure
1.
The growth inhibition of S. epidermidis.
Cultured S. epidermidis was incubated with and without purified PLTs. A: Turbidity of the S. epidermidis culture system for 10 hours. B: Growth curves of S. epidermidis co-cultured with or without purified PLTs in 24 hours by plates' bacterium count. C: Bacterium counts at 4, 8, 12, 16 and 20 hours after co-culture. Data are represented as mean ± SD, while all statistical results were triplicate tests. **P<0.01, ***P<0.001. SE: S. epidermidis cultured alone; M-SE: S. epidermidis co-cultured with plasma; PLT-SE: S. epidermidis co-cultured with platelets.
Platelets decreased the chromatin content of S. epidermidis and inhibited their proliferation
To additionally explore the direct anti-S. epidermidis effects, the morphology of S. epidermidis treated with platelets were investigated. Using transmission electron microscopy, we found that in the platelets-treated group the chromatin area of S. epidermidis shrunk and bright spots with low density appeared in the nuclear region as indicated by the arrows in Fig. 2A. These results suggest that platelets decreased the chromatin content of S. epidermidis.
Figure
2.
The cell division retardation effects of PLTs on S. epidermidis.
A: The ultrastructure of S. epidermidis was observed with transmission electron microscopy: S. epidermidis only (left), S. epidermidis co-cultured with plasma (middle), S. epidermidis co-cultured with platelets (right). Arrow 1 indicated the normal division of S. epidermidis; Arrow 2 indicated that the cytoplasm and cell wall of S. epidermidis separated after being co-cultured with plasma; Arrow 3 indicated that the cell wall of S. epidermidis fractured and the cell content over-flowed after being co-cultured with plasma; Arrow 4 indicated the abnormal DNA structure and DNA agglutination of S. epidermidis after being co-cultured with platelets. B: Statistical results of division bacteria observed by transmission electron microscopy. C: Cell division test using CFSE were analyzed with flow cytometry after being cultured for 10 hours. The black line is CFSE-stained S. epidermidis cultured alone; the blue line is CFSE-stained S. epidermidis co-cultured with plasma; the red line is CFSE-stained S. epidermidis co-cultured with PLTs. D: Statistical results of CFSE test. Data were represented as mean ± SD and all statistical results were triplicate tests. **P<0.01, ***P<0.001. SE: S. epidermidis cultured alone; M-SE: S. epidermidis co-cultured with plasma; PLT-SE: S. epidermidis co-cultured with platelets.
It was also found that the proportion of dividing bacteria decreased in the platelet-treated groups after 10 hours of culture (Fig. 2B). To affirm abnormalities in cell division, CFSE staining was used to observe their proliferation. As shown inFig. 2C–D, CFSE fluorescence intensity in S. epidermidis decreased significantly after platelet treatment. Altogether, these results suggest that platelets might inhibit the proliferation of S. epidermidis by influencing their nucleic acid synthesis.
G6PD is involved in inhibiting the proliferation of platelet-treated S. epidermidis
Ribose-5-phosphate, a product of PPP, is the precursor for the synthesis of nucleotides, and G6PD is one of the key enzymes in the PPP. Next, the changes in G6PD gene expression in S. epidermidis treated with platelets were evaluated. Using quantitative RT-PCR, the result found that the mRNA level of G6PD in S. epidermidis was lowered after platelet treatment (Fig. 3A). This suggests that platelets might modulate the PPP by down-regulating G6PD, consequently inhibiting the proliferation of S. epidermidis.
Figure
3.G6PD was involved in the regulation of S. epidermidis proliferation by PLTs.
S. epidermidis was co-cultured with or without washed PLTs for 10 hours. A: The mRNA level of G6PD fold changes co-cultured with or without washed PLTs detected by qRT-PCR. B: Bacterial counts after addition of GDL and IMP for 8 hours and plated for 24 hours. Data were represented as mean ± SD and all statistical results were from triplicate tests. *P<0.01, ***P<0.001. SE: S. epidermidis cultured alone; M-SE: S. epidermidis co-cultured with plasma; PLT-SE, S. epidermidis co-cultured with platelets; PLT/IMP, addition of IMP to the co-culture system; PLT/GDL, addition of GDL to the co-culture system.
To confirm our hypothesis, the compensation tests with IMP and GDL, which are two downstream molecules of G6PD, were performed. As shown in Fig. 3B, the number of bacterial cells was significantly increased after the addition of IMP or GDL for 10 hours. Taken together, this suggests that platelets might inhibit the proliferation of S. epidermidis by down-regulating G6PD.
DISCUSSION
Many studies have demonstrated that platelets have explicit anti-infective functions. Platelets can detect infections and deliver antimicrobial effector molecules in innate defense and bridge interactions with immunocytes such as B- and T-cells to shape adaptive immune responses[33–35]. However, diverse bacterial genera, and even different species of the same genus interact with platelets differentially[36–38]. S. epidermidis has emerged over recent decades as the most prevalent species of nosocomial pathogens[1–2]. Compared to the interaction between platelets and S. aureus, much less is known about S. epidermidis, which lacks obvious virulence determinants and is often viewed as an accidental pathogen.
Maghsoudi et al. recently compared the effect of PRPs on S. epidermidis with different platelet concentrations and found that the number of platelets significantly influence their inhibitory effect on S. epidermidis[29]. Furthermore, several studies demon-strated that human platelet antimicrobial proteins exhibited microbicidal activity against S. epidermidis[39–41]. These studies strongly suggest that platelets have intrinsic anti-S. epidermidis effects. However, S. epidermidis is also the most frequent aerobic pathogen isolated from contaminated platelet concentrates, a blood product for patients with low platelet counts and bleeding disorders. S. epidermidis can form surface-attached cell aggregates known as biofilms[42–43], which elevate their resistance to anti-biotics, disinfectants, and immune clearance[42, 44–46], and has been involved in transfusion septic reactions and even fatalities[47–48]. However, the precise factors that lead to S. epidermidis aggregation and biofilm formation are not yet clear. Platelets may offer an accidental niche for the colonization of S. epidermidis. Fibrinogen and certain specific immunoglobulins are also essential factors for aggregate formation. Kerrigan found that fibrinogen led to single platelet adhesion but not aggregate formation in a plasma-free system, while the addition of fibrinogen and specific immunoglobulin to the plasma-free system led to platelet adhesion followed by aggregate formation[49]. Thus, the exact interactions between platelets and S. epidermidis are obscure.
In an attempt to confirm the direct anti-S. epidermidis effects of platelets, we purified platelets from human peripheral blood and co-cultured them with S. epidermidis, which resulted in a significant inhibition of S. epidermidis growth and proliferation. It was also observed that the antibacterial effect of platelets was delayed but lasted longer compared with that of plasma. There could be three possible reasons: 1) Antibacterial substances secreted by various cells were already present in plasma, while those released from platelets required more time to reach the antibacterial concentration. 2) There were no new sources of antimicrobial substances in the plasma, which can be depleted or inactivated after a period, while those produced from platelet activation were able to supplement this depletion. 3) Platelets have their own antimicrobial ability, which differs from that of plasma. Overall, the study suggests and confirms that platelets have intrinsic anti-S. epidermidis effects and could interact with S. epidermidis directly.
Recently our research demonstrated that platelets could inhibit the growth of S. aureus directly, damage their DNA, and block cell division[50]. In the present study visual evidence of the DNA shrinkage and inhibition of cell division in platelet-treated S. epidermidis was presented. The main substrates for the synthesis of cell components and energy by bacteria are carbohydrates. Hence, we hypothesized that the inhibition of cell division and DNA shrinkage might be the results of modulation of glucose metabolism by platelets. The PPP is a ubiquitous pathway in bacteria for intermediary carbohydrate metabolism besides glycolysis. It plays various roles, including the generation of NADPH for reductive biosynthesis and precursors such as ribose-5-phosphate for the generation of nucleotides[51]. G6PD is one of the key enzymes in the PPP. It converts glucose-6-phosphate to GDL with the concomitant reduction of NADP+ to NADPH and subsequent oxidization to ribose-5-phosphate, which is a precursor for nucleic acid synthesis[52]. Therefore, the modulation of PPP in platelet-treated S. epidermidis was focused and G6PD as an important indicator was selected. This demonstrates that platelets can directly down-regulate G6PD along with the inhibition of S. epidermidis growth. Moreover, the addition of GDL or IMP, two downstream molecules of G6PD, alleviated the S. epidermidis growth inhibition effect caused by platelets, which confirmed this phenomenon. Overall, these findings provide new insights into the mechanism of how platelets inhibit the growth of S. epidermidis via the modulation of glucose metabolism. Platelets are known to play a critical role in antimicrobial innate immune response[53–55]. Platelets possess distinct granules that contain molecules which confer antimicrobial effects, release an array of antibacterial peptides including thymosin β–4, fibrinopeptide A and B, platelet basic protein, connective tissue-activating peptide 3, RANTES, and platelet factor 4[53]. They also produce various oxygen metabolites such as hydrogen peroxide, superoxide, and hydroxyl free radicals[54–55]. They can directly clear microorganisms from the blood stream[53]. The concept that platelets inhibit bacterial growth through the modulation of glucose metabolism is presented here for the first time, however the exact and detailed mechanism needs to be studied further.
In conclusion, the results suggest that platelets could inhibit the growth of S. epidermidis directly, damage their DNA, and block cell division. Moreover, further study showed that platelets could down-regulate G6PD, which codes for a key enzyme in the PPP. This might be a new antibacterial mechanism of platelets. This is the first study to represent the anti-microbial effects of platelets through the modulation of the glucose metabolism. Our findings shed new light on the interactions between platelets and bacteria.
Acknowledgments
We thank the volunteers for their platelet donations. This work was supported by the grant of the National Natural Science Foundation of China (No. 81873448).
Tande AJ, Osmon DR, Greenwood-Quaintance KE, et al. Clinical characteristics and outcomes of prosthetic joint infection caused by small colony variant staphylococci[J]. mBio, 2014, 5(5): e01910−14. doi: 10.1128/mBio.01910-14
[2]
Argemi X, Hansmann Y, Prola K, et al. Coagulase-negative staphylococci pathogenomics[J]. Int J Mol Sci, 2019, 20(5): 1215. doi: 10.3390/ijms20051215
[3]
Lamagni T. Epidemiology and burden of prosthetic joint infections[J]. J Antimicrob Chemother, 2014, 69(suppl_1): i5−i10. doi: 10.1093/jac/dku247
[4]
Li Z, Xiao Z, Li Z, et al. 116 cases of neonatal early-onset or late-onset sepsis: a single center retrospective analysis on pathogenic bacteria species distribution and antimicrobial susceptibility[J]. Int J Clin Exp Med, 2013, 6(8): 693–699.
[5]
Franceschi AT, da Cunha ML. Adverse events related to the use of central venous catheters in hospitalized newborns[J]. Rev Lat Am Enfermagem, 2010, 18(2): 196−202. doi: 10.1590/s0104-11692010000200009
[6]
Hira V, Sluijter M, Estevao S, et al. Clinical and molecular epidemiologic characteristics of coagulase-negative staphylococcal bloodstream infections in intensive care neonates[J]. Pediatr Infect Dis J, 2007, 26(7): 607−612. doi: 10.1097/INF.0b013e318060cc03
[7]
Hischebeth GT, Randau TM, Ploeger MM, et al. Staphylococcus aureus versus Staphylococcus epidermidis in periprosthetic joint infection-Outcome analysis of methicillin-resistant versus methicillin-susceptible strains[J]. Diagn Microbiol Infect Dis, 2019, 93(2): 125−130. doi: 10.1016/j.diagmicrobio.2018.08.012
[8]
Klingenberg C, Ronnestad A, Anderson AS, et al. Persistent strains of coagulase-negative staphylococci in a neonatal intensive care unit: virulence factors and invasiveness[J]. Clin Microbiol Infect, 2007, 13(11): 1100−1111. doi: 10.1111/j.1469-0691.2007.01818.x
[9]
Blair P, Flaumenhaft R. Platelet alpha-granules: basic biology and clinical correlates[J]. Blood Rev, 2009, 23(4): 177−189. doi: 10.1016/j.blre.2009.04.001
[10]
Gordon RJ, Miragaia M, Weinberg AD, et al. Staphylococcus epidermidis colonization is highly clonal across US cardiac centers[J]. J Infect Dis, 2012, 205(9): 1391−1398. doi: 10.1093/infdis/jis218
[11]
Raad I, Alrahwan A, Rolston K. Staphylococcus epidermidis: emerging resistance and need for alternative agents[J]. Clin Infect Dis, 1998, 26(5): 1182−1187. doi: 10.1086/520285
Versteeg HH, Heemskerk JW, Levi M, et al. New fundamentals in hemostasis[J]. Physiol Rev, 2013, 93(1): 327−358. doi: 10.1152/physrev.00016.2011
[14]
Kaufman RM, Djulbegovic B, Gernsheimer T, et al. Platelet transfusion: a clinical practice guideline from the AABB[J]. Ann Intern Med, 2015, 162(3): 205−213. doi: 10.7326/M14-1589
[15]
Estcourt LJ, Birchall J, Allard S, et al. Guidelines for the use of platelet transfusions[J]. Br J Haematol, 2017, 176(3): 365−394. doi: 10.1111/bjh.14423
[16]
Yeaman MR. Platelets: at the nexus of antimicrobial defence[J]. Nat Rev Microbiol, 2014, 12(6): 426−437. doi: 10.1038/nrmicro3269
[17]
Moutinho B, Pinto B, Cardoso R, et al. Platelets structure, function and modulator capacity in replacement therapy[J]. Cardiovasc Hematol Disord Drug Targets, 2017, 17(3): 180−184. doi: 10.2174/1871529X18666171227152937
[18]
Clark SR, Ma AC, Tavener SA, et al. Platelet TLR4 activates neutrophil extracellular traps to ensnare bacteria in septic blood[J]. Nat Med, 2007, 13(4): 463−469. doi: 10.1038/nm1565
[19]
Cognasse F, Nguyen KA, Damien P, et al. The inflammatory role of platelets via their TLRs and siglec receptors[J]. Front Immunol, 2015, 6: 83. doi: 10.3389/fimmu.2015.00083
[20]
Yount NY, Yeaman MR. Multidimensional signatures in antimicrobial peptides[J]. Proc Natl Acad Sci U S A, 2004, 101(19): 7363−7368. doi: 10.1073/pnas.0401567101
[21]
Durr M, Peschel A. Chemokines meet defensins: the merging concepts of chemoattractants and antimicrobial peptides in host defense[J]. Infect Immun, 2002, 70(12): 6515−6517. doi: 10.1128/IAI.70.12.6515-6517.2002
[22]
Tang YQ, Yeaman MR, Selsted ME. Antimicrobial peptides from human platelets[J]. Infect Immun, 2002, 70(12): 6524−6533. doi: 10.1128/IAI.70.12.6524-6533.2002
[23]
Zhang G, Han J, Welch EJ, et al. Lipopolysaccharide stimulates platelet secretion and potentiates platelet aggregation via TLR4/MyD88 and the cGMP-dependent protein kinase pathway[J]. J Immunol, 2009, 182(12): 7997−8004. doi: 10.4049/jimmunol.0802884
[24]
Abdulrehman AY, Jackson EC, McNicol A. Platelet activation by Streptococcus sanguinis is accompanied by MAP kinase phosphorylation[J]. Platelets, 2013, 24(1): 6−14. doi: 10.3109/09537104.2012.661105
[25]
Sullam PM, Frank U, Yeaman MR, et al. Effect of thrombocytopenia on the early course of streptococcal endocarditis[J]. J Infect Dis, 1993, 168(4): 910−914. doi: 10.1093/infdis/168.4.910
[26]
Sun H, Wang X, Degen JL, et al. Reduced thrombin generation increases host susceptibility to group A streptococcal infection[J]. Blood, 2009, 113(6): 1358−1364. doi: 10.1182/blood-2008-07-170506
[27]
Semple JW, Freedman J. Platelets and innate immunity[J]. Cell Mol Life Sci, 2010, 67(4): 499−511. doi: 10.1007/s00018-009-0205-1
[28]
Katz JN, Kolappa KP, Becker RC. Beyond thrombosis: the versatile platelet in critical illness[J]. Chest, 2011, 139(3): 658−668. doi: 10.1378/chest.10-1971
Maghsoudi O, Ranjbar R, Mirjalili SH, et al. Inhibitory activities of platelet-rich and platelet-poor plasma on the growth of pathogenic bacteria[J]. Iran J Pathol, 2017, 12(1): 79−87. doi: 10.30699/ijp.2017.23386
[31]
Hong H, Xiao W, Lazarus HM, et al. Detection of septic transfusion reactions to platelet transfusions by active and passive surveillance[J]. Blood, 2016, 127(4): 496−502. doi: 10.1182/blood-2015-07-655944
[32]
Jianjun W, Guiqiu S, Maohong B, et al. Guideline for the collection and preparation of non-transfusion autologous platelet concentrate or platelet-rich plasma from patients in hospitals[J]. Blood Genomics, 2021, 5(2): 73−82. doi: 10.46701/BG.2021022021128
[33]
Wong CH, Jenne CN, Petri B, et al. Nucleation of platelets with blood-borne pathogens on Kupffer cells precedes other innate immunity and contributes to bacterial clearance[J]. Nat Immunol, 2013, 14(8): 785−792. doi: 10.1038/ni.2631
[34]
Iannacone M, Sitia G, Isogawa M, et al. Platelets mediate cytotoxic T lymphocyte-induced liver damage[J]. Nat Med, 2005, 11(11): 1167−1169. doi: 10.1038/nm1317
[35]
Elzey BD, Sprague DL, Ratliff TL. The emerging role of platelets in adaptive immunity[J]. Cell Immunol, 2005, 238(1): 1−9. doi: 10.1016/j.cellimm.2005.12.005
[36]
Clawson CC, White JG. Platelet interaction with bacteria. I. Reaction phases and effects of inhibitors[J]. Am J Pathol, 1971, 65(2): 367–380.
[37]
Kessler CM, Nussbaum E, Tuazon CU. In vitro correlation of platelet aggregation with occurrence of disseminated intravascular coagulation and subacute bacterial endocarditis[J]. J Lab Clin Med, 1987, 109(6): 647–652.
[38]
Bayer AS, Ramos MD, Menzies BE, et al. Hyperproduction of alpha-toxin by Staphylococcus aureus results in paradoxically reduced virulence in experimental endocarditis: a host defense role for platelet microbicidal proteins[J]. Infect Immun, 1997, 65(11): 4652−4660. doi: 10.1128/iai.65.11.4652-4660.1997
[39]
Mohan KV, Rao SS, Gao Y, et al. Enhanced antimicrobial activity of peptide-cocktails against common bacterial contaminants of ex vivo stored platelets[J]. Clin Microbiol Infect, 2014, 20(1): O39−O46. doi: 10.1111/1469-0691.12326
Mohan KV, Rao SS, Atreya CD. Evaluation of antimicrobial peptides as novel bactericidal agents for room temperature-stored platelets[J]. Transfusion, 2010, 50(1): 166−173. doi: 10.1111/j.1537-2995.2009.02376.x
[42]
Khardori N, Yassien M, Wilson K. Tolerance of Staphylococcus epidermidis grown from indwelling vascular catheters to antimicrobial agents[J]. J Ind Microbiol, 1995, 15(3): 148−151. doi: 10.1007/BF01569818
[43]
Otto M. Staphylococcus epidermidis-the 'accidental' pathogen[J]. Nat Rev Microbiol, 2009, 7(8): 555−567. doi: 10.1038/nrmicro2182
[44]
Rupp ME, Ulphani JS, Fey PD, et al. Characterization of the importance of polysaccharide intercellular adhesin/hemagglutinin of Staphylococcus epidermidis in the pathogenesis of biomaterial-based infection in a mouse foreign body infection model[J]. Infect Immun, 1999, 67(5): 2627−2632. doi: 10.1128/IAI.67.5.2627-2632.1999
[45]
Vuong C, Voyich JM, Fischer ER, et al. Polysaccharide intercellular adhesin (PIA) protects Staphylococcus epidermidis against major components of the human innate immune system[J]. Cell Microbiol, 2004, 6(3): 269−275. doi: 10.1046/j.1462-5822.2004.00367.x
[46]
Kristian SA, Birkenstock TA, Sauder U, et al. Biofilm formation induces C3a release and protects Staphylococcus epidermidis from IgG and complement deposition and from neutrophil-dependent killing[J]. J Infect Dis, 2008, 197(7): 1028−1035. doi: 10.1086/528992
[47]
Benjamin RJ, Dy B, Perez J, et al. Bacterial culture of apheresis platelets: a mathematical model of the residual rate of contamination based on unconfirmed positive results[J]. Vox Sang, 2014, 106(1): 23−30. doi: 10.1111/vox.12065
[48]
Kou YT, Pagotto F, Hannach B, et al. Fatal false-negative transfusion infection involving a buffy coat platelet pool contaminated with biofilm-positive Staphylococcus epidermidis: a case report[J]. Transfusion, 2015, 55(10): 2384−2389. doi: 10.1111/trf.13154
[49]
Kerrigan SW, Clarke N, Loughman A, et al. Molecular basis for Staphylococcus aureus-mediated platelet aggregate formation under arterial shear in vitro[J]. Arterioscl Throm Vas Biol, 2008, 28(2): 335−340. doi: 10.1161/ATVBAHA.107.152058
[50]
Xu J, Yi J, Zhang H, et al. Platelets directly regulate DNA damage and division of Staphylococcus aureus[J]. FASEB J, 2018, 32(7): 3707−3716. doi: 10.1096/fj.201701190R
Zamboni N, Fischer E, Laudert D, et al. The Bacillus subtilis yqjI gene encodes the NADP+-dependent 6-P-gluconate dehydrogenase in the pentose phosphate pathway[J]. J Bacteriol, 2004, 186(14): 4528−4534. doi: 10.1128/JB.186.14.4528-4534.2004
[53]
Youssefian T, Drouin A, Masse JM, et al. Host defense role of platelets: engulfment of HIV and Staphylococcus aureus occurs in a specific subcellular compartment and is enhanced by platelet activation[J]. Blood, 2002, 99(11): 4021−4029. doi: 10.1182/blood-2001-12-0191
[54]
Yeaman MR. The role of platelets in antimicrobial host defense[J]. Clin Infect Dis, 1997, 25(5): 951−970. doi: 10.1086/516120
[55]
Krijgsveld J, Zaat SA, Meeldijk J, et al. Thrombocidins, microbicidal proteins from human blood platelets, are C-terminal deletion products of CXC chemokines[J]. J Biol Chem, 2000, 275(27): 20374−20381. doi: 10.1074/jbc.275.27.20374
Xiaoliang Li, Lanyue Hu, Chengning Tan, et al. Platelet-promoting drug delivery efficiency for inhibition of tumor growth, metastasis, and recurrence. Frontiers in Oncology, 2022, 12: 983874.
DOI:10.3389/fonc.2022.983874
DownLoad:
